Stability of Proteins and Nucleic acids MCQ Quiz - Objective Question with Answer for Stability of Proteins and Nucleic acids - Download Free PDF

Last updated on Jul 3, 2025

Latest Stability of Proteins and Nucleic acids MCQ Objective Questions

Stability of Proteins and Nucleic acids Question 1:

Which of the following statements are true about protein folding and stability?
A. Disulfide bonds stabilize protein structures in reducing environments.
B. Hydrogen bonding between side chains and water molecules contributes to protein solubility.
C. The entropy of the solvent increases as hydrophobic residues bury in the protein core.
D. Heat shock proteins assist in the proper folding of newly synthesized proteins.

  1. A and C only
  2. B and D only
  3. B, C, and D
  4. All of the above

Answer (Detailed Solution Below)

Option 3 : B, C, and D

Stability of Proteins and Nucleic acids Question 1 Detailed Solution

- www.khautorepair.com

The correct answer is B, C, and D

Explanation:

A. Disulfide bonds stabilize protein structures in reducing environments: Incorrect.

  • Disulfide bonds stabilize protein structures, but they form and stabilize proteins in oxidizing environments, not reducing environments.
  • Reducing environments (such as the cytoplasm) tend to break disulfide bonds, whereas oxidizing environments (such as the ER lumen) favor the formation of disulfide bonds.

B. Hydrogen bonding between side chains and water molecules contributes to protein solubility: Correct.

  • Hydrogen bonds play a crucial role in maintaining protein solubility by allowing hydrophilic side chains to interact with water molecules, keeping the protein dissolved in the aqueous environment.
  • These interactions help stabilize the protein's structure and make it soluble in cellular environments.

C. The entropy of the solvent increases as hydrophobic residues are buried in the protein core: Correct.

  • This statement refers to the hydrophobic effect, where hydrophobic residues tend to cluster together inside the protein core, away from water.
  • As these hydrophobic residues are buried in the protein core, the structured water molecules around them are released, increasing the entropy (disorder) of the surrounding solvent.

D. Heat shock proteins assist in the proper folding of newly synthesized proteins: Correct.

  • Heat shock proteins (chaperones) are a class of proteins that assist in the folding of nascent polypeptides, prevent aggregation, and help refold misfolded proteins.
  • They play a critical role in maintaining cellular protein homeostasis, especially under stress conditions like increased temperatures.

Stability of Proteins and Nucleic acids Question 2:

Consider the following statements regarding the conformation and stability of DNA forms:

  1. The sugar puckering conformation plays a significant role in defining the geometry of the DNA helix. B-DNA typically has a C2'-endo sugar pucker, while A-DNA exhibits a C3'-endo conformation.
  2. Hydrogen bonding between base pairs influences the melting temperature (Tm) of DNA. Guanine-Cytosine (G-C) rich regions have a higher Tm compared to Adenine-Thymine (A-T) rich regions.
  3. The anti and syn configurations of the glycosidic bond are predominantly found in purine bases, with Z-DNA showing a unique pattern of syn for purines and anti for pyrimidines.
  4. The major groove of A-DNA is narrower and less accessible to protein interactions compared to that of B-DNA, which has a more open and wider major groove.

Which of the following options correctly identifies the TRUE statements?

  1. Only statements 1 and 2 are true

  2. Statements 1, 2, and 3 are true

  3. Statements 2, 3, and 4 are true

  4. All four statements are true

Answer (Detailed Solution Below)

Option 4 :

All four statements are true

Stability of Proteins and Nucleic acids Question 2 Detailed Solution

The correct answer is All four statements are true.

Explanation:

Statement 1: "The sugar puckering conformation plays a significant role in defining the geometry of the DNA helix. B-DNA typically has a C2'-endo sugar pucker, while A-DNA exhibits a C3'-endo conformation." : TRUE

  • The sugar puckering in DNA refers to the conformation of the deoxyribose sugar ring. It significantly influences the overall geometry of the DNA helix.
  • B-DNA: In this form, the sugar adopts a C2'-endo conformation, meaning the 2' carbon of the sugar ring is positioned above the plane.
  • A-DNA: The sugar puckering is C3'-endo, meaning the 3' carbon is positioned above the plane.
  •  

Statement 2: "Hydrogen bonding between base pairs influences the melting temperature (Tm) of DNA. Guanine-Cytosine (G-C) rich regions have a higher Tm compared to Adenine-Thymine (A-T) rich regions.": TRUE

  • The melting temperature (Tm) of DNA depends on the hydrogen bonding between base pairs.
  • G-C pairs have three hydrogen bonds, while A-T pairs have only two hydrogen bonds.
  • Therefore, DNA regions rich in G-C pairs have a higher Tm compared to regions rich in A-T pairs due to the stronger bonding.

Statement 3: "The anti and syn configurations of the glycosidic bond are predominantly found in purine bases, with Z-DNA showing a unique pattern of syn for purines and anti for pyrimidines." : TRUE

  • The glycosidic bond between the base and the sugar can adopt two orientations: anti and syn.
  • In B-DNA and A-DNA, bases are usually in the anti-conformation for both purines and pyrimidines.
  • In Z-DNA, the purines (especially guanine) adopt the syn conformation, while the pyrimidines (cytosine) remain in the anti conformation.

Statement 4: "The major groove of A-DNA is narrower and less accessible to protein interactions compared to that of B-DNA, which has a more open and wider major groove." : TRUE

  • A-DNA has a more compact structure, with a narrower major groove that is indeed less accessible to protein interactions.
  • In contrast, B-DNA has a wider and more open major groove, which is the main site for protein binding and interactions.

Conclusion: Based on the analysis, all four statements are accurate All four statements are true

Stability of Proteins and Nucleic acids Question 3:

Which sugar pucker conformation dominates in the hybrid duplex where one strand is RNA and the other strand is DNA?

  1. C-2' endo in the RNA strand
  2. C-3' endo in both strands
  3. C-2' endo in both strands
  4. C-3' endo in the RNA strand and C-2' endo in the DNA strand

Answer (Detailed Solution Below)

Option 4 : C-3' endo in the RNA strand and C-2' endo in the DNA strand

Stability of Proteins and Nucleic acids Question 3 Detailed Solution

The correct answer is C-3' endo in the RNA strand and C-2' endo in the DNA strand

Explanation:

Sugar Pucker refers to the spatial arrangement of the sugar moiety in nucleotides, specifically the ribose in RNA and deoxyribose in DNA.
There are two primary pucker conformations for sugars in nucleotides:

  • C-2' endo: The 2' carbon atom of the sugar is pushed "up" towards the base (endo conformation), leading to a more folded structure.
  • C-3' endo: The 3' carbon atom is pushed "up," resulting in a different spatial arrangement.

The sugar puckers in DNA/RNA structures are predominately in either C3'-endo (A-DNA or RNA) or C2'-endo (B-DNA), corresponding to A or B form conformation. 

c2 endoc3 endo

RNA (Ribonucleic Acid):

  • The preferred pucker conformation in RNA is C-3' endo. This conformation stabilizes the RNA structure by promoting interactions between the backbone and the bases.
  • The C-3' endo pucker allows RNA to adopt a more compact and stable helical structure, accommodating the complex secondary structures (like hairpins and loops) that RNA can form.

DNA (Deoxyribonucleic Acid):

  • The sugar in DNA is deoxyribose, which lacks the hydroxyl group at the 2' position (it has only a hydrogen atom at this location).
  • In DNA, the preferred pucker is C-2' endo. This configuration contributes to the right-handed helical structure of DNA (B-form), allowing optimal stacking of base pairs and stability.

When RNA and DNA form a hybrid duplex, the distinct conformational preferences must be accommodated in the structure:

  • The RNA strand will adopt the C-3' endo conformation due to its ribose sugar structure.
  • The DNA strand will adopt the C-2' endo conformation as it is more stable for deoxyribose.

Stability of Proteins and Nucleic acids Question 4:

Beta barrel structures cannot be predicted by hydropathy plot analysis. Choose the most appropriate reason behind this phenomenon.
A.  Presence of a stretch of hydrophobic amino acids in its linear sequence
B.  Absence of hydrophobic amino acids in the secondary structure of beta barrel
C . Presence of alternating hydrophilic and hydrophobic amino acid residues in the primary sequence of beta barrel
D . Presence of alternating cis and trans amino acid residues in its primary sequence

  1. A and C
  2. B only
  3. C only
  4. D only

Answer (Detailed Solution Below)

Option 3 : C only

Stability of Proteins and Nucleic acids Question 4 Detailed Solution

The correct answer is C only

Concept:

Hydropathy Plot: A hydropathy plot measures the hydrophobicity or hydrophilicity of amino acids in a protein sequence to predict membrane-spanning regions, typically identifying stretches of hydrophobic amino acids that could form transmembrane helices.

Beta-Barrel Structures: Beta-barrels are composed of beta-strands that form a cylindrical, barrel-like structure. These structures are commonly found in the outer membranes of bacteria, mitochondria, and chloroplasts. The key characteristic of beta-barrels is the presence of alternating hydrophilic (water-attracting) and hydrophobic (water-repelling) amino acids along each beta-strand.

Explanation:

(A) Presence of a stretch of hydrophobic amino acids in its linear sequence:- This is a characteristic of alpha-helices in membrane proteins but not beta-barrels.
(B) Absence of hydrophobic amino acids in the secondary structure of beta-barrel:- This is incorrect because beta-barrels do contain hydrophobic amino acids; these hydrophobic residues tend to face the lipid environment, while hydrophilic residues face the aqueous interior or exterior.
(C) Presence of alternating hydrophilic and hydrophobic amino acid residues in the primary sequence of beta-barrel:- This is correct. The alternating pattern means that no long stretch of consecutive hydrophobic or hydrophilic residues exists to be detected by hydropathy plots, which seek consecutive hydrophobic regions indicative of transmembrane helices.
(D) Presence of alternating cis and trans amino acid residues in its primary sequence:- There is no specific pattern of cis and trans amino acids related to beta-barrels that affects hydropathy plot predictions.

Stability of Proteins and Nucleic acids Question 5:

At pH 7.0, tryptophan crosses a lipid bilayer at about one thousandth the rate of the closely related substance indole. The correct explanation for this observation at pH 7.0 is:

  1. Tryptophan bears a net negative charge
  2. Tryptophan bears a net positive charge
  3. Tryptophan bears a positive and a negative charge
  4. Tryptophan cannot bind to its transporter in the lipid bilayer

Answer (Detailed Solution Below)

Option 3 : Tryptophan bears a positive and a negative charge

Stability of Proteins and Nucleic acids Question 5 Detailed Solution

The correct answer is Option 3

Explanation:

  • Tryptophan is one of the 20 standard amino acids used by cells to synthesize proteins. It features an indole functional group attached to an α-amino group (-NH3+) and an α-carboxyl group (-COO-). Its side chain is relatively large and contains a double ring system, which includes the indole ring.
  • Indole, on the other hand, consists solely of a double ring structure and lacks both the amino group and the carboxyl group present in tryptophan. Indole is essentially the component that gives tryptophan its aromatic character, but it is smaller and lacks the polar groups found in the full amino acid.

F1 Teaching   Priya 15 5 2024 D1

F1 Teaching   Priya 15 5 2024 D2

  • At physiological pH (~7.0), amino acids, including tryptophan, exist primarily in a zwitterionic form.
  • This means they have both positively and negatively charged groups due to the ionization of the amino group (forming -NH3+) and the carboxyl group (forming -COO-). The zwitterionic form is neutral overall in terms of net charge, but it possesses distinct regions of positive and negative charge.

Tryptophan crosses lipid bilayer more slowly because:-

  • Tryptophan's Zwitterionic Form: At physiological pH, tryptophan's positively and negatively charged groups make it more polar and less capable of diffusing through the hydrophobic core of the lipid bilayer. These charges lead to its interactions with water molecules, making it hydrophilic and hindering its ability to cross the hydrophobic membrane without assistance, such as via transport proteins.
  • Indole's Hydrophobic Nature: Indole lacks these charged groups, making it more hydrophobic and able to integrate more readily into the hydrophobic interior of the lipid bilayer. Its smaller size and nonpolar nature facilitate its passive diffusion across the membrane.

Conclusion:

The significant difference in the rate at which tryptophan and indole cross the lipid bilayer at physiological pH can be attributed to their structural differences and the resulting physicochemical properties. Tryptophan's charged groups at physiological pH hinders its ability to cross the hydrophobic interior of lipid bilayers.

Top Stability of Proteins and Nucleic acids MCQ Objective Questions

Stability of Proteins and Nucleic acids Question 6:

Arrange the DNA fragments (A to D) in the order of decreasing melting temperature.  

A.

5'‐ AGTAGTATCAACTATCATGA‐3'

3'‐ TCATCATAGTTGATAGTACT‐5'

B.

5'‐ GACGTGCCAGGTGCGAGGTC‐3' 

3'‐ CTGCACGGTCCACGCTCCAG‐5' 

C.

5'‐ TACGATGCACATGCTTGGAC‐3' 

3'‐ ATGCTACGTGTACGAACCTG‐5' 

D.

5'‐ GAACGCTACGTTGCGATCCG‐3' 

3'‐ CTTGCGATGCAACGCTAGGC‐5' 

  1.  B > D > C > A
  2. C > A > B > D
  3. D > C > A = B
  4.  A = B > C > D 

Answer (Detailed Solution Below)

Option 1 :  B > D > C > A

Stability of Proteins and Nucleic acids Question 6 Detailed Solution

Key Points

  • DNA double helix are held togther by hydrogen bonds. 
  • Varied conditions such as pH, ionic strength and temperature can disrupt the hydrogen bonds in the DNA leading to the separation of the DNA strands.
  • This process of separation of the double-stranded DNA is called denaturation of the DNA. 
  • Change in the physical properties of the DNA results in denaturation of the DNA. 
  • Relative absorption of the DNA solution increases due to denaturation, this phenomenon is called hyperchromicity.
  • Hyperchromicity is due to the base-stacking of the double-stranded DNA that decreases the amount of UV light absorbed by the duplex DNA. 
  • The midpoint of absorption increase is called the melting point (Tm)
  • Following are the factors that affects Tm:
    1. G-C content - High the G-C content of the DNA helix, highest is the melting temperature.
    2. Ionic strength - Lower the ionic strength, lower the melting point of the DNA. Salt shields the negative charge of the sugar-phosphate backbone of the DNA strands, with lower salt concentration, more electrostatic repulsion favours the strands separation.
    3.  pH - At pH above 10, deprotonation of bases occurs which destroys the hydrogen bond formation potential and leads to strands separation. At pH below 3, extensive protonation of the bases occurs which also disrupts the hydrogen bonding between the DNA leading to the separation of the strands. 

Explanation:

  • DNA fragment A has 14 A-T base pairs and 6 G-C base pairs.
  • DNA fragment B has 6 A-T base pairs while 14 G-C base pairs.
  • DNA fragment C has 10 A-T base pairs and 10 G-C base pairs.
  • DNA fragment B has 8 A-T base pairs while 12 G-C base pairs.
  • Higher the G:C content, higher is the melting point of the DNA fragment.
  • So, fragment B with have the highest melting point because it has highest G-C content, then fragment D will have the second highest melting point, then fragment C and lastly fragment A will have the lowest melting point because they have the lowest G-C content.
  • So, the order of decreasing melting point is B > D > C > A.

Hence, the correct answer is option 1.

Stability of Proteins and Nucleic acids Question 7:

Which of the following statement is/are true?

A.Cooperativity coefficient is a parameter in Hill's plot.

B.Bohr's effect is observed in myoglobin.

C.Myoglobin is an allosterically-regulated protein.

D.At low pH oxygen binds to hemoglobin weaker than at high pH.

  1. A only
  2. C only
  3. A and D only
  4. B and C only

Answer (Detailed Solution Below)

Option 3 : A and D only

Stability of Proteins and Nucleic acids Question 7 Detailed Solution

The correct answer is Option 3 i.e.A and D only

Explanation:

A.Cooperativity coefficient is a parameter in Hill's plot.

  • The Hill coefficient is a measure of cooperativity in binding, such as the binding of oxygen to hemoglobin. 
  • The Hill's plot is a graphical method used to analyze the cooperativity of ligand binding to a protein.

The Hill equation is represented as:\(\ [ \theta = \frac{[L]^n}{K_d + [L]^n} ]\), where

  • (\(\theta\)) is the fraction of the ligand-binding sites that are occupied,
  • [L] is the concentration of the ligand,
  • (Kd) is the dissociation constant, 
  • (n) is the Hill coefficient.

The Hill coefficient (n) serves as a measure of cooperativity in ligand binding:

  • If (n > 1), the binding exhibits positive cooperativity.
  • If (n = 1), the binding is non-cooperative.
  • If (n < 1), the binding exhibits negative cooperativity.

Therefore, Statement A is true because the Hill coefficient, a direct measure of cooperativity in the context of ligand binding, is indeed an important parameter derived from Hill's plot.

B.Bohr's effect is observed in myoglobin.

  • The Bohr effect describes how the binding affinity of hemoglobin for oxygen decreases (oxygen is released more readily) in the presence of increased concentrations of carbon dioxide and hydrogen ions (lower pH). This physiological mechanism helps deliver oxygen more effectively to tissues that need it most, such as actively metabolizing muscles.
  • Myoglobin, by contrast, serves as an oxygen storage protein primarily in muscle tissue and has a single oxygen-binding site. It does not exhibit cooperative binding as it can bind only one molecule of oxygen at a time, and its oxygen-binding affinity is not directly affected by pH and CO2 levels in the same way as hemoglobin. Thus, Statement B is false because the Bohr effect specifically describes a property of hemoglobin, not myoglobin.

C. Myoglobin is an allosterically-regulated protein.

  • Allosteric regulation refers to the regulation of a protein's activity through the binding of an effector molecule at a site other than the protein's active (or primary ligand-binding) site. This can lead to changes in the protein's conformation that either enhance or diminish its activity.
  • Myoglobin's structure and function do not align with allosteric regulation principles. Myoglobin has a single heme group that binds oxygen, and it does not exhibit conformational changes in response to the binding of effector molecules in the same way that allosterically regulated proteins like hemoglobin do.
  • Hemoglobin's oxygen affinity is altered by factors like pH, CO2 concentration, and 2,3-Bisphosphoglycerate (2,3-BPG), showing allosteric regulation.
  • Myoglobin is primarily concerned with oxygen storage within muscle tissues and shows a hyperbolic oxygen dissociation curve, indicating a lack of cooperative interaction typical of allosteric systems. Therefore, Statement C is false.

D. At low pH oxygen binds to hemoglobin weaker than at high pH.

  • This statement accurately describes the Bohr effect. Hemoglobin's oxygen-binding affinity is inversely related to the concentration of hydrogen ions (pH) and carbon dioxide in the blood.
  • At lower pH (higher concentration of hydrogen ions), hemoglobin binds to oxygen with a lower affinity.
  • This mechanism is physiologically advantageous because it promotes oxygen release in tissues where it is most needed those producing more CO2 and H⁺ ions due to higher metabolic activity. As the pH drops, hemoglobin undergoes a conformational change that facilitates the release of oxygen. Thus, Statement D is true.

Conclusion:-

Therefore, the correct statements are A and D

Stability of Proteins and Nucleic acids Question 8:

What will be the molecular weight of the peptide with sequence ELTTEK following its backbone cyclization to cyclic - (ELTTEK)? [Molecular weights - E : 147, L : 131, T : 119, K : 146]

  1. 699 
  2. 700 
  3. 701 
  4. 800

Answer (Detailed Solution Below)

Option 3 : 701 

Stability of Proteins and Nucleic acids Question 8 Detailed Solution

The correct answer is 701

Explanation:

To determine the molecular weight of the peptide with the sequence ELTTEK after cyclization, we first need to calculate the molecular weight of the linear sequence and then account for the loss of a water molecule (H₂O) due to cyclization (formation of a peptide bond between the NH₂ group of the N-terminal amino acid and the COOH group of the C-terminal amino acid).

Calculate the sum of the molecular weights of the individual amino acids:

  • E (Glutamate) = 147 g/mol
  • L (Leucine) = 131 g/mol
  • T (Threonine) = 119 g/mol
  • T (Threonine) = 119 g/mol
  • E (Glutamate) = 147 g/mol
  • K (Lysine) = 146 g/mol

Total molecular weight for the linear sequence 147 + 131 + 119 + 119 + 147 + 146 = 809 g/mol

  • When the peptide is cyclized, a peptide bond forms between the N-terminal amino acid and the C-terminal amino acid, leading to the loss of water molecule (H2O: 18 g/mol)
  • Each water molecule (H₂O) has a molecular weight of 18 g/mol. If 6 water molecules are lost: 6 x 18 g/mol = 108 g/mol

Therefore, the molecular weight of the cyclic peptide is 809 g/mol - 108 g/mol= 701 g/mol.

Stability of Proteins and Nucleic acids Question 9:

The oligopeptide F-A-R-P-M-T-S-R-P-G-F, is treated with trypsin, chymotrypsin and carboxypeptidase-B. Apart from the original peptide, the number of fragments obtained will be:

  1. 4
  2. 3
  3. 2
  4. 0

Answer (Detailed Solution Below)

Option 4 : 0

Stability of Proteins and Nucleic acids Question 9 Detailed Solution

Key Points:
  • F (Phenylalanine)-A(Alanine)-R(Arginine)-P(Proline)-M(Methionine)-T(Threonine)-S(Serine)-R(Arginine)-P(Proline)-G(Glycine)-F(Phenylalanine) is the oligopeptide chain treated with the trypsin, chymotrypsin and carboxypeptidases where, there will no fragmentation.

Important Points:

  • Trypsin, chymotrypsin are endopeptidases and will cleave only internal bonds.
  • Carboxypeptidases are exopeptidases cleaves amino acid at C-terminus.
  • Trypsin is formed in the small intestine when its proenzyme form, the trypsinogen produced by the pancreas, is activated.
  • Trypsin, a serine protease is an enzyme.
  • Trypsin cuts peptide chains mainly at the carboxyl side of the amino acids lysine or arginine and so it will not breakdown the oligopeptide with the bond succeeding with proline, methionine and threonine.
  • Chymotrypsin is a digestive enzyme which breaks down tryptophan, phenylalanine, and tyrosine.
  • Chymotrypsin will not breakdown the oligopeptide chain because it will not be able to cleave 1st and last bonds.
  • An example of an exopeptidase is the trypsin-activated pancreatic protease carboxypeptidase.
  • There are two forms of this proteolytic enzyme, A and B.
  • The carboxypeptidases cleave single amino acids off the free carboxyl ends of proteins.
  • Carboxypeptidase A cleaves off aromatic or branched chain amino acids; carboxypeptidase B cleaves off basic amino acids.
  • Carboxypeptidases that cleave positively charged amino acids (arginine, lysine) are called carboxypeptidase B (B for basic).
  • The end result of pancreatic proteolysis is some free amino acids and a mixture of oligopeptides.
  • However, carboxypeptidase will not breakdown the above oligopeptide because it acts only on lysine, arginine or ornithine at C-terminus.

Hence the correct answer is option 4

Stability of Proteins and Nucleic acids Question 10:

In protein secondary structure, the α-helix is stabilized by:

  1. Hydrophobic interactions
  2. Disulfide bridges between cysteine residues
  3. Hydrogen bonds between side chains of amino acids
  4. Hydrogen bonds between the carbonyl oxygen and amide hydrogen of backbone amides

Answer (Detailed Solution Below)

Option 4 : Hydrogen bonds between the carbonyl oxygen and amide hydrogen of backbone amides

Stability of Proteins and Nucleic acids Question 10 Detailed Solution

The correct answer is Option 4 i.e.Hydrogen bonds between the carbonyl oxygen and amide hydrogen of backbone amides

Explanation:-

  • The α-helix is one of the primary forms of secondary structure found in proteins. It is a right-handed coil or helical structure, where each turn of the helix comprises 3.6 amino acid residues. The stability and structure of the α-helix are critically dependent on hydrogen bonds that form within the backbone of the protein.
  • These hydrogen bonds occur between the carbonyl oxygen (C=O) of one amino acid residue and the amide hydrogen (N-H) of another amino acid residue that is four positions ahead in the primary sequence of the protein.
  • This means the hydrogen bond forms between the carbonyl oxygen of the nth amino acid and the amide hydrogen of the (n+4)th amino acid.
  • These hydrogen bonds are intramolecular (occurring within the same molecule) and are regularly spaced along the helix, giving the α-helix its characteristic stability and shape.

Key Points A) Hydrophobic interactions: While hydrophobic interactions play a significant role in the tertiary (3D) structure of proteins, by driving hydrophobic side chains to the interior, away from the aqueous environment, they are not the primary stabilizing force in the formation of the α-helix. The α-helix is mainly stabilized by hydrogen bonds in its backbone.

B) Disulfide bridges between cysteine residues: Disulfide bridges are covalent bonds that form between the sulfur atoms of cysteine residues. These bonds can play a crucial role in stabilizing the tertiary or quaternary structures of proteins by linking different parts of a chain or different chains together but are not directly involved in the stabilization of the α-helix.

C) Hydrogen bonds between side chains of amino acids: Hydrogen bonds between side chains can contribute to the stabilization of secondary, tertiary, and quaternary structures of proteins but are not the key stabilizing interactions in the alpha-helix. In the α-helix, the important hydrogen bonds occur between the backbone atoms (carbonyl oxygen and amide hydrogen) rather than between the side chains.

D) Hydrogen bonds between the carbonyl oxygen and amide hydrogen of backbone amides: This is the correct option. The α-helix structure is stabilized primarily by hydrogen bonds that occur between the carbonyl oxygen of one amino acid residue and the amide hydrogen of another amino acid residue that is four positions ahead. These hydrogen bonds are essential for maintaining the integrity and stability of the α-helix structure.

Stability of Proteins and Nucleic acids Question 11:

Purine and pyrimidine nucleotides serve as monomeric units of the nucleic acid polymers DNA and RNA. Mentioned below are some of the statements with respect to the de novo synthesis of nucleotides. Which one of the following statements is INCORRECT?

  1. Biosynthesis of both purine and pyrimidine nucleotides begin with ribose‐5‐phosphate and purine or pyrimidine rings are built on it. 
  2. The first purine nucleotide biosynthesized by de novo pathway is inosinic acid or inosine‐monophosphate. 
  3. The first pyrimidine nucleotide biosynthesized by de novo pathway is orotidylic acid or orotidine monophosphate. 
  4. Thymidylate or TMP is synthesized as deoxy‐TMP from deoxy‐UMP by thymidylate synthetase. 

Answer (Detailed Solution Below)

Option 1 : Biosynthesis of both purine and pyrimidine nucleotides begin with ribose‐5‐phosphate and purine or pyrimidine rings are built on it. 

Stability of Proteins and Nucleic acids Question 11 Detailed Solution

Key Points

  • Nucleotide is building block of nucleic acid and it is made of sugar, phosphate and nitrogenous base.
  • The pathway of nucleotide biosynthesis is divided into two classes - de novo pathway and salvage pathway. 
  • In the de novo pathway of nucleotide biosynthesis, the nucleotide bases are synthesized from simple components. 
  • In salvage pathway, performed bases are recovered and joined to ribose unit. 
  • Both pathways leads to the synthesis of ribonucleotides and deoxyribonucleotide are synthesized from the corresponding ribonucleotides. 
  1. De novo synthesis of pyrimidine:
    • The pyrimidine ring is synthesized first then it is coupled to ribose -structure. 
    • For the biosynthesis of pyrimidine rings, carbamoyl phosphate and aspartate react to form carbamoyl aspartate, which then cyclises to form dihydroorotate. 
    • Dihydroorotate is oxidised to form orotate.
    • Orotate then couple with ribose structure (PRPP) to form orotidylate (OMP).
    • OMP the undergo decarboxylation reaction to form UMP.
    • UMP acts as the precursor for CTP and TMP.
  2. De novo synthesis of purine:
    • de novo synthesis of purine is some what different as the purine ring is assembly piece by piece on the ribose structure. 
    • In the ribose-5-phosphate is converted to PRPP by the action of enzyme PRPP synthase.
    • PRPP react with glutamate to form 5-phosphoribosylamine. This is the committed step in the purine synthesis. 
    • IMP is the first purine nucleotide of the de novo pathway.
    • IMP acts as the precursor for AMP and GMP.

Explanation:

Option 1:

  • Purine rings are built on a ribose-5-phosphate scaffold provided by PRPP (5-phosphoribosyl-1-pyrophosphate).
  • For pyrimidine nucleotides, this is not entirely correct. The pyrimidine ring is synthesized first and then attached to ribose-5-phosphate
  • Ribose-5-phosphate react with ATP to form phosphoribosylpyrophosphate (PRPP), this reaction is catalyzed by PRPP synthase enzyme where the β,γ - diphosphoryl group of ATP is transfer to ribose-5-phosphate. PRPP thus form is used for the biosynthesis of purine and pyrimidine.
  • Hence, this is an incorrect statement.

Option 2:

  • In purine synthesis, the first purine nucleotide is IMP which acts as the precursor of AMP and GMP.
  • Hence, this is a correct statement.

Option 3:

  • This is correct. In the de novo synthesis pathway of pyrimidines, the first nucleotide formed is orotidine-5'-monophosphate (OMP), which is then converted into UMP (uridine monophosphate).

Option 4:

  • Thymidylate synthetase is an folate-dependent enzyme in pyrimidine biosynthesis that catalyzes the reductive methylation of deoxyuridylate (dUMP) and 5,10-methylenetetrahydrofolate to deoxythymidine monophosphate (dTMP) and 7,8-dihydrofolate.
  • It is the sole de novo synthesis reaction for biosynthesis of thymine in DNA.
  • Hence, this is a correct statement.

Stability of Proteins and Nucleic acids Question 12:

Consider the following statements regarding the conformation and stability of DNA forms:

  1. The sugar puckering conformation plays a significant role in defining the geometry of the DNA helix. B-DNA typically has a C2'-endo sugar pucker, while A-DNA exhibits a C3'-endo conformation.
  2. Hydrogen bonding between base pairs influences the melting temperature (Tm) of DNA. Guanine-Cytosine (G-C) rich regions have a higher Tm compared to Adenine-Thymine (A-T) rich regions.
  3. The anti and syn configurations of the glycosidic bond are predominantly found in purine bases, with Z-DNA showing a unique pattern of syn for purines and anti for pyrimidines.
  4. The major groove of A-DNA is narrower and less accessible to protein interactions compared to that of B-DNA, which has a more open and wider major groove.

Which of the following options correctly identifies the TRUE statements?

  1. Only statements 1 and 2 are true

  2. Statements 1, 2, and 3 are true

  3. Statements 2, 3, and 4 are true

  4. All four statements are true

Answer (Detailed Solution Below)

Option 4 :

All four statements are true

Stability of Proteins and Nucleic acids Question 12 Detailed Solution

The correct answer is All four statements are true.

Explanation:

Statement 1: "The sugar puckering conformation plays a significant role in defining the geometry of the DNA helix. B-DNA typically has a C2'-endo sugar pucker, while A-DNA exhibits a C3'-endo conformation." : TRUE

  • The sugar puckering in DNA refers to the conformation of the deoxyribose sugar ring. It significantly influences the overall geometry of the DNA helix.
  • B-DNA: In this form, the sugar adopts a C2'-endo conformation, meaning the 2' carbon of the sugar ring is positioned above the plane.
  • A-DNA: The sugar puckering is C3'-endo, meaning the 3' carbon is positioned above the plane.
  •  

Statement 2: "Hydrogen bonding between base pairs influences the melting temperature (Tm) of DNA. Guanine-Cytosine (G-C) rich regions have a higher Tm compared to Adenine-Thymine (A-T) rich regions.": TRUE

  • The melting temperature (Tm) of DNA depends on the hydrogen bonding between base pairs.
  • G-C pairs have three hydrogen bonds, while A-T pairs have only two hydrogen bonds.
  • Therefore, DNA regions rich in G-C pairs have a higher Tm compared to regions rich in A-T pairs due to the stronger bonding.

Statement 3: "The anti and syn configurations of the glycosidic bond are predominantly found in purine bases, with Z-DNA showing a unique pattern of syn for purines and anti for pyrimidines." : TRUE

  • The glycosidic bond between the base and the sugar can adopt two orientations: anti and syn.
  • In B-DNA and A-DNA, bases are usually in the anti-conformation for both purines and pyrimidines.
  • In Z-DNA, the purines (especially guanine) adopt the syn conformation, while the pyrimidines (cytosine) remain in the anti conformation.

Statement 4: "The major groove of A-DNA is narrower and less accessible to protein interactions compared to that of B-DNA, which has a more open and wider major groove." : TRUE

  • A-DNA has a more compact structure, with a narrower major groove that is indeed less accessible to protein interactions.
  • In contrast, B-DNA has a wider and more open major groove, which is the main site for protein binding and interactions.

Conclusion: Based on the analysis, all four statements are accurate All four statements are true

Stability of Proteins and Nucleic acids Question 13:

Beta barrel structures cannot be predicted by hydropathy plot analysis. Choose the most appropriate reason behind this phenomenon.
A.  Presence of a stretch of hydrophobic amino acids in its linear sequence
B.  Absence of hydrophobic amino acids in the secondary structure of beta barrel
C . Presence of alternating hydrophilic and hydrophobic amino acid residues in the primary sequence of beta barrel
D . Presence of alternating cis and trans amino acid residues in its primary sequence

  1. A and C
  2. B only
  3. C only
  4. D only

Answer (Detailed Solution Below)

Option 3 : C only

Stability of Proteins and Nucleic acids Question 13 Detailed Solution

The correct answer is C only

Concept:

Hydropathy Plot: A hydropathy plot measures the hydrophobicity or hydrophilicity of amino acids in a protein sequence to predict membrane-spanning regions, typically identifying stretches of hydrophobic amino acids that could form transmembrane helices.

Beta-Barrel Structures: Beta-barrels are composed of beta-strands that form a cylindrical, barrel-like structure. These structures are commonly found in the outer membranes of bacteria, mitochondria, and chloroplasts. The key characteristic of beta-barrels is the presence of alternating hydrophilic (water-attracting) and hydrophobic (water-repelling) amino acids along each beta-strand.

Explanation:

(A) Presence of a stretch of hydrophobic amino acids in its linear sequence:- This is a characteristic of alpha-helices in membrane proteins but not beta-barrels.
(B) Absence of hydrophobic amino acids in the secondary structure of beta-barrel:- This is incorrect because beta-barrels do contain hydrophobic amino acids; these hydrophobic residues tend to face the lipid environment, while hydrophilic residues face the aqueous interior or exterior.
(C) Presence of alternating hydrophilic and hydrophobic amino acid residues in the primary sequence of beta-barrel:- This is correct. The alternating pattern means that no long stretch of consecutive hydrophobic or hydrophilic residues exists to be detected by hydropathy plots, which seek consecutive hydrophobic regions indicative of transmembrane helices.
(D) Presence of alternating cis and trans amino acid residues in its primary sequence:- There is no specific pattern of cis and trans amino acids related to beta-barrels that affects hydropathy plot predictions.

Stability of Proteins and Nucleic acids Question 14:

The oligopeptide A-K-V-R-F-W-G-K-T is treated with trypsin, chymotrypsin. Apart from the original peptide, the number of fragments obtained will be:

  1. 5
  2. 4
  3. 3
  4. 2

Answer (Detailed Solution Below)

Option 1 : 5

Stability of Proteins and Nucleic acids Question 14 Detailed Solution

The correct answer is Option 1 i.e. 5

Concept:

  • Trypsin, chymotrypsin are endopeptidases and will cleave only internal bonds.
  • Carboxypeptidases are exopeptidases cleaves amino acid at C-terminus.

Enzymes specificity:

  • Trypsin cleaves at the C-terminal side of lysine (K) and arginine (R), but not if followed by proline (P).
  • Chymotrypsin cleaves at the C-terminal side of aromatic amino acids (W, Y, F), but not if followed by proline (P).
  • Carboxypeptidase-A cleaves at the C-terminal end, removing amino acids one at a time, preferentially removing aliphatic and aromatic side chains except Lys(K) and Arg (R)

Explanation:

Trypsin Action

  • Trypsin cleaves at the C-terminal side of lysine (K) and arginine (R).
  • A-K → AK | VR | FWGKT
  • Trypsin is an endopeptidase that cleaves at the C-terminal side of lysine (K) and arginine (R) except when these residues are proximal to the C-terminal where it cannot act as an exopeptidase.

Chymotrypsin Action

  • Chymotrypsin cleaves at the C-terminal side of phenylalanine (F), tryptophan (W), and tyrosine (Y).
  • After F → AK | VR | F | WGKT
  • After W → AK | VR | F | W  | GKT

After action by trypsin and chymotrypsin,the generated fragments are:-

  • AK
  • VR
  • F
  • W
  • GKT

This means trypsin and chymotrypsin action results in 5 distinct fragments apart from the original peptide: AK, VR, F, W, GKT.

Stability of Proteins and Nucleic acids Question 15:

Which of the following would contribute towards strand separation during DNA melting?

  1. Hydrogen bonding between nitrogenous bases
  2. Repulsion between phosphate groups
  3. Van der Waals interaction between nitrogenous bases
  4. High G+C content

Answer (Detailed Solution Below)

Option 2 : Repulsion between phosphate groups

Stability of Proteins and Nucleic acids Question 15 Detailed Solution

Concept:

  • Denaturation is the complete unwinding and separation of the complementary single strand. DNA that has been denatured has two single strands.
  • Double-stranded DNA is more stable as compared to single-stranded.
  • Ionic strength, pH, and base composition determine the strength of double-strand DNA. By increasing the pH or temperature, or by sharply reducing the ionic strength, the double strand of DNA can be denatured.
  • The non-covalent forces that hold the two strands of DNA together weaken and eventually disintegrate when a DNA solution is heated sufficiently. This results in a process known as DNA denaturation also referred to as DNA melting, where the two strands split apart.
  • The melting temperature, or Tm, is the temperature at which the DNA strands are halfway denatured.
  • The single strands of DNA rejoin to create the B form of DNA when the denatured DNA is restored to physiological conditions.
  • The two strands of DNA repel one another because of the negative charge of phosphate groups. 
  • The ionic phosphate groups of DNA interact with monovalent or divalent cations like Na+, Mg2+, Mn2+, and Co2+ when salt is introduced, acting as a shielding agent (repulsive force is reduced), thereby stabilizing the DNA.

Explanation:

  • Option 1: Hydrogen bonding between the nitrogen bases.
    • DNA double helix is stabilised by non-covalent interactions that include stacking interactions and hydrogen bonds.
    • Hydrogen bonds between complementary bases are one of the stabilising factors in the DNA double helix. 
    • Hence, this is an incorrect option.
  • Option 2: Repulsion between phosphate groups.
    • Repulsion between the phosphate group is one of the major destabilising factors in the DNA helix. 
    • This electrostatic repulsion of the charged sugar-phosphate backbone is increased when the non-covalent interactions are disintegrated due to heat.
    • Hence, this is the correct option. 
  • Option 3: Van der Waals interaction between nitrogen bases.
    • Base stacking interaction is the main stabilising factor in the DNA double helix. 
    • Base-stacking interaction is a non-covalent van der Waals force that holds together adjacent bases, thereby increasing the overall stability of the DNA double helix. 
    • Hence, this is an incorrect option.
  • Option 4: High G+C content.
    • A-T base pairing is always destabilising while G-T base pairing is stabilising factor in the DNA double helix. 
    • Higher G+C content increases the overall stability of the DNA double helix.
    • Hence, this is an incorrect option. 

Hence, the correct answer is option 2.

Get Free Access Now
Hot Links: teen patti download teen patti go teen patti master apk best